Текущее время: Ср апр 14, 2021 11:52 am

Store Store Forum
Полезные инструкции! Инструкция по регистрации в магазине Mornatural Инструкция по оплате в магазине Mornatural
Мы в социальных сетях! Blog Blog Instagram Facebook ВКонтакте Twitter

По следам Инстаграма doclana.mornatural

Форум о здоровье и обсуждение различных заболеваний.

Модератор: Модераторы

Re: По следам Инстаграма doclana.mornatural

Сообщение MorNat » Ср мар 03, 2021 8:46 am

Вирусы в паразитах.
Мне бы хотелось, чтобы Вы этот пост восприняли ШИРЕ, чем просто и «якобы» о трихомонадах.

Многие простейшие паразиты (трихомонады, лейшмании, лямблии, наглерии, плазмодии, амеба, криптоспородии) инфицированы СВОИМИ вирусами.

Эти вирусы НЕ инфицируют позвоночных, но их геномы с двухцепочечной РНК идентифицируются нашей Врожденной иммунной системой и вызывают воспалительные реакции.

Трихомонада Vaginalis - простейший ПАРАЗИТ, который поражает мочеполовые пути и приводит к бактериальному вагинозу, повышенной восприимчивости к вирусу ВИЧ, ВПЧ и к репродуктивным осложнениям.

Половина изолятов T. vaginalis несут в себе вирусы dsРНК (TVV), которые не наносят вреда им самим.

Предположили, что эти вирусы воспринимаются (без заражения) иммунной человека, что приводит к воспалению и репродуктивным осложнениям.

Чтобы проверить эту гипотезу, культуры эпителиальных клеток человека из женского репродуктивного тракта подвергались Т. vaginalis TVV зараженным и трихомонадам, не зараженными вирусами.

Вирус-зараженные паразиты индуцировали выработку интерферона и ПРОвоспалительных цитокинов, в то время, как вирус-свободные трихомонады - нет.

Чтобы дать объяснение неспособности антибиотиков предотвратить осложнения, связанные с T. Vaginalis, зараженными TVV вирусами, их и трихомонады незараженные обрабатывали метронидазолом в течение 24 часов.
Супернатанты (назовем их грубо экстракты) от вируссодержащих, обработанные метранидазолом «индуцировали цитокины TLR3-зависимым образом». Цитокины не индуцировались с использованием супернатантов T. vaginalis, лишенных TVV вирусов.
Эти результаты предполагают, что лечение антибиотиками инфицированных вирусами T. vaginalis вызывает последующую воспалительную реакцию иммунной за счет высвобождения из трихомонад вирионов TVV и их вирусной dsРНК.
Эти интригующие результаты показывают, что вирусы паразитарных инфекций (в частности речь идет о простейших) могут восприниматься человеческой иммунной системой и приводить к более стойкой воспалительной реакции. Лечить такое будет сложнее.
В слизистой оболочке влагалища такая реакция на антибиотики зараженных трихомонад ахиллесова пята и палка о двух концах. Это может вызвать локальное воспаление, но и может привести к повышенной восприимчивости к другим бактериальным и вирусным инфекциям.
Поэтому (на таком примере, который все-таки, исходя из научных исследований не стоит обобщать широко, пока, но все же гипотезы возможны), когда вас беспокоит хронический ничем не снимающийся ГЭ рефлюкс, хронические язвы/эрозии ЖКТ, хронический кандидоз, хроническая персистирующая вирусная, когда полипы, миомы, кисты, спайки растут, как огурцы на огороде в дождливое лето, я предлагаю посмотреть на возможные паразитарные инфекции. Но не спешите, притормозите «травить паразитов». «Всех УБИТЬ и немедленно», будьте интеллигентными людьми )), тем более, что следующим постом (научное исследование)
я собираюсь Вас (нас) обескуражить еще больше.
Не замечали, что лечите паразитарную, а она только «затихает», чтобы потом опять напомнить о себе или, когда лаб показатели ПОСТлечения только ухудшаются; лечите бесконечными «схемами» кандиду, а она не отступает? А герпес и подавно, каждую неделю-две обострение, несмотря на весь арсенал средств?
В продолжение и на примере T. Vaginalis, нужны, конечно, дополнительные исследования, клинические. Но уже сейчас мы понимаем, что в лечении паразитарной необходимы противовирусные (и такие методы в лечении паразитов, в науке, уже начали предполагать), а в лечении вирусных противопаразитарные и ковид, как не странно это для многих, показал такой пример на ивермектине. Далее, в комплексном лечении вирусных/паразитарных мы можем предполагать необходимую противовоспалительную и даже иммуномодулирующую? Да.
Окантуем это в рамках T. Vaginalis и более формально. Результаты этой работы могут определить, должно ли использование противовирусных препаратов для подавления репликации TVV вирусов простейших паразитов, а также противовоспалительных средств
сопровождать терапию АБ-ками для предотвращения осложнений, связанных с инфекцией T. vaginalis.
Да, конечно, должно! Мы то с Вами это отлично уже знаем. Любая терапия должна быть КОМПЛЕКСНОЙ, для того, чтобы быть УСПЕШНОЙ.
РасскАжите, что поняли? Как собираетесь эту инфо примерить к своему случаю? Что измените в СВОЕМ «протоколе»? Какие у Вас сложности в лечении того, что я перечислила выше? Что еще к комплексному лечению инфекций из того, о чем я «трублю» часто, Вы бы еще добавили? Какие подходы?


(Предлагаю обратить внимание на продукцию CellCore в нашем магазине @mornatural_rus! У меня пошли отзывы от клиентов через консультации. Вот там они сразу многие учли; можете заглянуть в магазин, посмотреть их комплексы, в них подсказки на мои вопросы).
И пожалуйста, не отчаивайтесь по Здоровью, какое бы на сейчас оно не было это только «стадия», а не окончательный статус.

♥️
Аватара пользователя
MorNat
Супермодератор
 
Сообщения: 4960
Зарегистрирован: Сб фев 12, 2011 7:50 pm
Откуда: U.S. Iowa
Имя: Светлана

Re: По следам Инстаграма doclana.mornatural

Сообщение MorNat » Пт мар 12, 2021 8:50 am

Антикоагулянты для беременных, КОВИД.
Беременность само по себе состояние гиперкоагуляции, риск тромбоэмболии у беременных выше, чем у небеременных.

У всех беременных имеют место изменения в системе гемостаза, изменения сосудистой стенки и нарушения тока крови, но не у всех развивается тромбоз.

Факторы риска тромботических осложнений у беременных (БЕЗ КОВИД):

✔️Вес = и более 120 кг

✔️Эпизод ВТЭ (венозная тромбоэмболия) у родственников первой и второй линии

✔️прием пероральных контрацептивов до беременности

✔️дефицит антитромбина 3

✔️дефицит протеина C

✔️дефицит протеина S

✔️мутация фактора V Лейдена

✔️мутация протромбина (G20210A)

✔️антифосфолипидные антитела

✔️определенные полиморфизмы фолатного цикла

✔️гестеционный диабет и др заболевания

Этим пунктам присвоены баллы, затем высчитывается их сумма.

Менее 1,0 балла – без фармакологической тромбопрофилактики

1,0-1,5 балла – до 6 недель после родов

2,0-2,5 балла – с 28 недель беременности до 6 недель после родов

3,0 и более баллов – в течение всей беременности и 6 недель после родов

Показатели коагулограммы могут определять противопоказания для фарм тромбопрофилактики: тромбоциты менее 75*109, АПТВ, МНО более 1,5 от нормы, фибриноген менее 1 г/л.

Американский Колледж Акушеров и Гинекологов (ACOG), что, хотя нет данных за или против тромбопрофилактики при Ковид-19 во время беременности, профилактика ВТЭ должна быть рассмотрена, особенно у госпитализированных с Ковид-19.

Если нет противопоказаний, то рекомендует профилактическое назначение низкомолекулярного гепарина всем госпитализированным беременным женщинам

Коагулограмма у беременных в норме отличается от норм небеременных. Так во время беременности уровень D-димера не может быть надежным предиктором ВТЭ, потому что на протяжении всей беременности наблюдается физиологическое повышение уровня D-димера. Свертываемость крови тоже возрастает и это часть нормального физиологического процесса беременности. Однако у густой крови есть побочные эффекты, поэтому риск тромбозов у беременных повышен.
Этот риск сохраняется после родов, особенно в течение первых 2-3-х недель.
Сочетание двух факторов риска — беременности и КОВИД увеличивает риск последствий.
Антикоагулянты прямого действия обычно не используются во время беременности из-за отсутствия данных о безопасности.
Варфарин следует избегать, не применяется во время беременности, он тератогенен, особенно в 1 триместр.
Только группу гепарина можно во время беременности*
Конкретные рекомендации для беременных или кормящих женщин с Ковид-19 включают:
✔️ если антитромботическая терапия назначена во время беременности до постановки диагноза Ковид-19, то она продолжатся.
✔️беременным, госпитализированным по поводу тяжелой формы Ковид-19, рекомендуются профилактические дозы антикоагулянтов, если нет противопоказаний (рисков кровотечений).
✔️низкомолекулярный гепарин не накапливается
в грудном молоке и не вызывает антикоагулянтного эффекта у новорожденного; может быть использован кормящими женщинами с Ковид-19 или без него, которым требуется профилактика или лечение ВТЭ.
✔️ использование антикоагулянтов прямого действия во время беременности не рекомендуется из-за отсутствия данных о безопасности для плода и новорожденного.
В чем преимущества именно низкомолекулярного гепарина.
- Не проникают через плаценту
- Есть антидот – протамина сульфат
- Более управляемый и прогнозируемый эффект
- Меньше риск кровотечения
- Можно использовать амбулаторно
- Быстро реабсорбируются -через 20-30 мин при п/к введении
- Обладают высокой биодоступностью -90-99%, тогда, как у стандартного гепарина 20%-имеет
- Противовоспалительный эффект (ВАЖНО при КОВИД)
Препараты:
▫️Эноксапарин (клексан)20–40 мг 1 раз в сутки подкожно
▫️Дальтепарин (фрагмин)2500–5000 МE 1–2 раза сут
▫️Надропарин (фраксипарин)0,3–0,6 мл (2850–5700 ME)1 раз/сут
▫️Бемипарин (цибор) - 2500-3500 ЕД п/к
Дозы подбирать ТОЛЬКО с ВРАЧОМ‼️
Что следует помнить еще? ВОДА является ВАЖНЕЙШИМ компонентом свертываемости крови, поэтому, ПИТЬ ВОДУ в течение дня! Особенно, если вы заболели и температурите, при любой инфекции загущается кровь. Расчет воды на день: 30 мл умножаем на ваш вес тела. При высокой свертываемости крови прибавляем еще пол-литра. Пьем воду с лимонным соком, если заболели.
Более вязкой кровь делают откровенно плохие продукты: трансжиры -маргарин, выпечки с ним, сахар, полуфабрикаты, фаст фуд, много мяса/копченостей, алкоголь. Кстати, кроме красного вина, оно разжижает кровь в больших дозах (это НЕ призыв к действию!), но вы беременны и алкоголь СТРОГО запрещен.
Лук, чеснок, лимон/грейпфрут, вишня, жирные кислоты из жирной рыбы, запечённый картофель в мундире, свекла, имбирь, какао, ягоды (шелковица, красная смородина, малина), семена подсолнечника, кунжутное масло –разжижают кровь. Вот это и употреблять в КОВИД, и беременность.
Рыбий жир я всегда рекомендую беременным. Магний и калий уменьшают склеивание тромбоцитов. Томаты в любом виде по действию на тромбоциты сравнимы с аспирином и = 4 среднего размера помидорам в день.
Беременным в течение первых 3 месяцев назначается вит Е, я предпочитаю, когда используются все его 8 форм, желательно в 1-2 препаратах. Зачем в первые 3 мес беременности?
Для повышения чувствительности прогестероновых рецепторов, он же замедляет свертываемость крови. Дефицит вит С, цинка и селена будут предрасполагать к загущению крови.
Но все эти средства и продукты хороши, как профилактика, а не в то время, когда уже нужна помощь фармпрепаратов. Т. е они вспомогательные, а не терапевтические и не взаимозаменяемые.
Здоровья и счастливой беременности!
❤️
Аватара пользователя
MorNat
Супермодератор
 
Сообщения: 4960
Зарегистрирован: Сб фев 12, 2011 7:50 pm
Откуда: U.S. Iowa
Имя: Светлана

Re: По следам Инстаграма doclana.mornatural

Сообщение MorNat » Чт мар 18, 2021 8:44 am

КОВИД особенности у детей.

Следует отметить, что дети редко болеют КОВИД-19 в тяжелой форме. Коронавирус распространяется воздушно-капельным путем и проникает через слизистые рта/носа, а у детей в клетках слизистых меньше выражен ACE2, поэтому Ков-2 имеет меньше шансов проникнуть в детский организм.

У детей так же имеет место незрелость иммунного ответа и это препятствует развитию гипериммунного ответа и ОРДС. 10% детей нуждаются в госпитализации и в среднем 1% имеют тяжелое течение.

Только у небольшой части детей при Ковид-19 возможно развитие Синдрома Мультисистемного Воспалительного Ответа.

На первой стадии заболевания, которая длится в течение 3-7 суток, происходит репликация вируса и противовирусные НЕОБХОДИМЫ. Мы их не раз разбирали во многих постах и ПЭ, но детям НЕ применяются противомалярийные препараты.

В редких случаях Ков-2 может инициировать патологический ответ иммунной, который только у части детей, в основном подросткового возраста, может достигать уровня цитокинового шторма. Гиперответ иммунной приводит к патологической активации системы гемостаза с диффузным тромбообразованием -это вторая стадия заболевания, которая длится около недели. Тромбозы могут образовываться в любых органах, но типичная локализация -легкие.

Третья стадия Ковид-19 наступает после 14-16 суток с момента начала заболевания и характеризуется или выздоровлением ребенка, или при неблагоприятном течении развитием осложнений.

У детей нередко наблюдается диарея, намного чаще вирус проявляется симптомами ЖКТ, чем у взрослых.

Признаки цитокинового шторма:
нейтрофильный лейкоцитоз с лимфопенией (лейкоциты могут падать ниже 3), РЕЗКОЕ повышение СРБ (более 60), прокальцитонина (> 2 нг/мл), СОЭ, ЛДГ, трансаминаз, интерлейкина-6 (более 40), ферритина (более 500) и D-димера, падение альбумина, повышение триглицеридов, температура выше 38.5 более суток, одышка с центральным цианозом, сатурация менее 93%, гипонатремия (падает натрий), повышается билирубин, повышается прокальцитонин, падают тромбоциты.

При развитии полиорганной недостаточности вдвое могут повышаться уровни АЛТ, АСТ, ГГТ, мочевины и креатинина.

Когда нужна госпитализация:
-температура выше 38 более 3-5 дней (или ниже 36!), одышка в покое, сатурация менее 93,
тахипноэ (учашенное дыхание), не связанное с лихорадкой:
-до 1 года –более 50
-от 1 до 5 лет –более 40
-старше 5 лет –более 30 дыханий/мин
-угнетенное сознание, судороги
-тахикардия, которая не связана с высокой температурой
-сатурация менее 95%
-хронические заболевания сердца/почек/легких/печени, диабет, ожирение.
-увеличение лимфатических узлов
-отеки/сыпь

При КОВИД-19 имеет место состояние гиперкоагуляции и у детей тоже, поэтому назначение прямых антикоагулянтов с известной или предполагаемой инфекцией показано всем детям, которые госпитализируются и тем, у которых есть факторы, предрасполагающие к тромбообразованию:
-тяжелое состояние ребенка
-наличие хронических заболеваний, как антифосфолипидного синдрома, ожирения, онкологии, ССЗ, заболеваний дыхательной системы.
-если уже были эпизоды тромбозов
-длительная вынужденная иммобилизация (травмы, параличи)
- наличие внутривенных катетеров
-изменение показателей коагулограммы в сторону гиперкоагуляции.

Рассматриваются показатели гемостаза:
✔️ D-димера
✔️ фибриноген
✔️ протромбин по Квику
✔️ протромбиновое время
✔️ АЧТВ

Показания к профилактике ВТЭ (венозная тромбоэмболия) у госпитализированных детей с COVID-19 должны быть такими же, как и у госпитализированных детей без КОВИД-19.

Коагулограмма и д-димер делаются каждые 2 дня при состоянии средней тяжести и ежедневно(!) при состоянии тяжелом.

Для определения повреждения миокарда проверяют: уровень тропонина, NT-proBNP, КФК-МБ фракции.

При отсутствии тромботических осложнений с профилактической целью госпитализированным детям рекомендовано применение низкомолекулярных гепаринов (НМГ) на время пребывания в стационаре.
НМГ предпочтительнее для терапии и профилактики тромбозов т.к. его биодоступность -98%, больший период полувыведения, редко развивается гепарин-индуцированная тромбоцитопения.

Предпочтение отдается Фрагмину. Дозы рассчитаны по возрасту. Вводится 1 раз в сутки, подкожно при контроле Анти-Ха активности (0,15 - 0,3 МЕ/мл) через 4 часа после инъекции, может быть рассмотрен один раз.

С целью коррекции доз дополнительно контролируют:
✔️ уровень протеина С
✔️ антитромбина III

Противопоказания для назначений антикоагулянтой терапии:
❗продолжающееся кровотечение
❗уровень тромбоцитов в крови ниже 25*109/л
❗выраженная почечная недостаточность (для гепарина).

ФДА США, Россия тоже, одобрило использование у детей ривароксабана (10 мг в день) в течение

21–39 дней при КОВИД-19 с факторами риска тромбообразования.

Критерии включения в исследования, в которых изучалась профилактика ВТЭ после выписки, включали:

-Оценка риска ВТЭ ≥4; или же ≥2 и уровень D-димера > 2 раза выше верхней границы нормы

В случае тромбоцитоза (повышение тромбоцитов выше 450 тыс 109/л) дополнительно назначается антиагрегантная терапия -аспирин 3 мг/кг в сутки.

В случае, если ребенок получал пероральные антикоангулянты до поступления в стационар, то на время стационарного лечения рекомендуется перевести на терапию низкомолекулярным гепарином в течение 2-3 нед с последующим переводом вновь на пероральные антикоагулянты.

Когда будут использоваться глюкокортикоиды (метилпред, дексаметазон):
-ферритин выше 600, снижение тромбоцитов ниже 180, снижение уровня лейкоцитов ниже 3, лимфопения, быстрое (в течение суток) снижение тромбоцитов и лейкоцитов в более, чем 2 раза, повышение АСТ и триглицеридов, снижение фибриногена ниже 360, гипоксемия, Мультисистемный Воспалительный Синдром.

Здоровья! Повторюсь, детям даются все те же нутрицевтики, что и взрослым, о которых я уже не раз писала. И хорошо, если вы даете ребенку, до заболевания, вит/мин комплексы (качественные и в активных формах), адаптогенные формулы –курсами, рыбий жир, вит С, пробиотики-курсами, профилактически обрабатываете слизистые, корректируете питательные дефициты и применяете принципы противовоспалительного питания.


❗Позаботьтесь, чтобы вся вирус-аптечка была уже дома, заготовленная заранее.

❤️
Аватара пользователя
MorNat
Супермодератор
 
Сообщения: 4960
Зарегистрирован: Сб фев 12, 2011 7:50 pm
Откуда: U.S. Iowa
Имя: Светлана

Re: По следам Инстаграма doclana.mornatural

Сообщение MorNat » Ср мар 24, 2021 8:50 am

Анестетики при КОВИД, опыт практиков

Возвращаясь к лидокаину (lidocaine/procaine) и пообщавшись с медиками здесь. Выдержка из одного исследования 2006 года:

«МОЩНЫЕ ПРОТИВОВОСПАЛИТЕЛЬНЫЕ свойства местных анестетиков(лидокаина/прокаина/лигнокаина), превосходящие в нескольких аспектах НПВП и СТЕРОИДЫ, и с МЕНЬШИМ количеством побочных эффектов, побудили клиницистов применять их при лечении различных заболеваний, связанных с ВОСПАЛЕНИЕМ, успешно применены при лечении: интерстициального цистита, язвенного проктита, артрита и инфекций, вызванных простым герпесом и др».
Лидокаин может ЭФФЕКТИВНО уменьшить кашель без каких-либо других значительных побочных эффектов:

✔️ Канадский журнал анестезииэ. Март 2020 «Лидокаин во время интубации и экстубации у пациентов с коронавирусной болезнью (COVID-19)»

✔️Британский Мед Журнал. Март 2020 «Внутривенный лидокаин для профилактики послеоперационных осложнений со стороны дыхательных путей у взрослых –метаанализ».

✔️Британский Мед Журнал. Май 2020 «Вспышка нового коронавируса: что нужно знать анестезиологам».

Большинство коллег предпочитают не прокаин 1%, а 1-2% лидокаин сбалансировать цитокины –иммунный ответ, которые могут соревноваться по своим противовоспалительным эффектам со стероидами, как уже я процитировала выше.

Дело в том, что вы часто пишите мне, что не знаете, когда необходимо подключать стероиды, другие их серьезно опасаются и даже многие госпитали, Украины, например, не применяют, видимо, из-за опасения побочных эффектов (повышение АД, повышение сахара крови, тромбообразование, угнетение иммунитета, психологические реакции); ПЛЮС есть уже группы постковид людей, которые не могут с них уйти из-за массивных, мучительных побочных эффектов отмены, даже, если они были использованы в течение короткого курса 1-2 недели.

Лидокаин играет заместительную роль стероидов, только имеет др механизм действия и меньшие побочные эффекты. Узнала, что ряд коллег уже давно разгружают от работы ЛОР, назначая своим пациентам спреи прокаина-1% при тонзиллитах, хр синусите, поллинозах, аллергических ринитах, вирусных ринитах, которые сопровождаются массивным воспалением и при которых нередко применяются стероидные препараты.

Пакистан ФЕВРАЛЬ 2020 года, ГОД НАЗАД, НАЧАЛО пандемии, предложенный метод лечения:
«Lignocaine’s substantial role in COVID-19 management: potential remedial and therapeutic implications» -Существенная роль лигнокаина в лечении КОВИД-19: потенциальные лечебные и терапевтические последствия».

Методология: «Впервые оценивается вероятная лечебная и терапевтическая роль небулайзер-примененного лигнокаина против SARS CoV-2 с использованием баз данных PubMed, MEDLINE, NHS Evidence и Web of Science».

«Имея доказательства того, что ингаляционный лигнокаин успешно использовался ранее при респираторных заболеваниях, и установленная роль низкоконцентрированного лигнокаина в качестве агента реполяризации ионных каналов (натриевых каналов), мы пытаемся интерпретировать значение лигнокаина, как противовоспалительного агента от SARS-CoV, а также, возможно, как противовирусного».

Заключение исследования: «Обладая противовоспалительным действием и потенциальным противовирусным действием, ингаляционный лигнокаин может стать ПРОРЫВОМ в управлении текущей пандемии».

Переписка с одним из авторов статьи: «Единственный способ успешного лечения КОВИД - это назальный лигнокаин (гель) для случаев легкой и средней тяжести ковид и лигнокаин в небулайзере для сатурации ниже 90%. Он определенно работает при любых вирусных, бактериальных и грибковых инфекциях дыхательных путей. Кроме того, он окажется успешным при туберкулезе и раке легких».

Когда вирус попадает в систему хозяина, в нем уже существует
разнообразие ионной активности для вирусных белков. Вирусы образуют виропорин –вирусный белок, мишенью которых выступают Na+ зависимые ионные каналы. Виропорины играют жизненно важную роль не так в репликации вируса, как в его быстром распространении. Они повышают проницаемость клеточных мембран и обнаружены во множестве вирусных геномов, но особенно часто встречаются у РНК-вирусов.

Многие вирусы экспрессируют виропорины: гепатита С,ВИЧ-1, вирус гриппа А, полиовирус, респираторно-синцитиальный вирус, SARS-CoV вируса.
Патогенез почти всех респираторных вирусов проявляется ингибированием амилорид-чувствительных эпителиальных Na+ каналов (ENaC). Короновирусы разрушают ENaC напрямую, тем самым нарушая клеточную Na+ абсорбцию, и напрямую вызывая повреждение эпителия, что приводит к воспалению (цитокиновому шторму) и отеку эпителиального
слоя легких. Цитокины взаимодействуют с ENaC, вызывая нарушение газообмена, вызывая накопление жидкости в легких. Препараты лидокаинового ряда реполяризуют ENaC, разрушает випарины и меняют вышеупомянутые механизмы.

«Лидокаин был признан, как сильнодействующее противовоспалительное средство, работающее наравне со стероидами. Лигнокаин -антиаритимический препарат класса II-b, также кардиопротективный препарат. Блокируя натриевые каналы - ENaC (ворота клетки) и реполяризируя их, проявляет свои антиаритмические свойства, обладает хорошими антиноцицептивными свойствами – действует на систему нейронов и медиаторных систем ствола мозга и тем самым угнетает боль; обладает также широким спектром, in vitro и in vivo (в живых организмах), характеристиками иммуномодулятора, антибактериального и противоканцерогенного агента. Испытания на животных показали, что у пациентов с астмой лигнокаин не только уменьшает воспаление эпителия легких, но также уменьшает выработку слизи и обращает вспять фиброз».

«Lignocaine’s substantial role in COVID-19 management: Potential
remedial and therapeutic implications» Февр 2020 Исследование:

«Обсуждаемые здесь свидетельства ясно показывают, что распространение и репликация вируса осуществляется по Na+ зависимым ионным каналам и вред, причиненный вирусом, начинается от легкого воспаления до ОРДС, вызывая отек легких и фиброз, также регулируется за счет взаимодействия цитокинов и ионных каналов. Также ясно, что лигнокаин является мощным реполяризующим
агент при введении в разбавленной низкой концентрации. Следовательно, после интерпретации всех доказательств и нашего клинического опыта, мы предлагаем, ингаляции лигнокаином, как потенциально терапевтический препарат при текущей КОВИД-19».

В Ираксом исследовании впервые использовался раствор 1.5 мл 2% лигнокаина и 3.5 мл дистиллированной воды, или 3 мл 2% лигнокаина и 7 мл дистилл воды при Ковид, в небулайзере (ингалятор), каждые 6 часов -4 раза в сутки от момента начала симптоматики или кашля, повышения температуры. Рекомендовано ничего не пить и не есть 45 мин до и 45 мин после ингаляции. Применяется 5-7 дней.

Медиками успешно используется 2% лидокаин -2 мл на 2 -3 мл 0.9% физраствора, ингаляции в теч 15-20 мин, 3 раза в день. У нас был подробный эфир по этому методу с Док Мурадином Узденовым - @ma_uzdenov (много инфо и много отзывов в его аккаунте!). У меня тоже, очень хорошие результаты с лидокаином/лигнокаином.
У лидокаина/лигнокаина могут быть осложенения, но в высокой концентрации, низкие концентрации и ингаляционным методом, в основном, переносятся легко.
Применяется ингаляции в любой стадии заболевания.

Возможно применение детям старше 3 лет, только в бОльшем разведении 1 мл 2% лидокаина на 3 мл физ раствора. Первая ингаляция аккуратно, меньше по времени и в более высоком разведении –см @ma_uzdenov .

Лидокаин/лигнокаин -вазоконстриктор короткого действия и может после ингаляции вызывать кашель, который проходит минут через 15-20. Если такое имеет место, то можно перед следующей ингаляцией использовать одну дозу сальбутамола.

Первый раз, чтобы посмотреть реакцию на лидокаин можно сделать ингаляцию в теч 5-7 мин и в бОльшем разведении.

Эта же группа докторов из Ирака –авторы статьи (показывая свои пустые койки в ковид госпитале прошлой зимой/весной), рекомендовали при легкой степени болезни использовать лидокаиновый гель назально, каждый час-два в первые дни болезни; его можно использовать и профилактически. Они же утверждают, что использование лигнокаина таким методом безопасно для беременных с ков инфекцией. Они отмечают, что этот метод более эффективен, если не использовались никакие антибиотики, тем более они только усугубляют процесс в случаях вирусной пневмонии.
Рекомендация Док. М Узденов: «Для получения эффекта важно лечение с первых дней болезни и использование ингалятора, который создает частицы 3 микрон (иначе раствор не попадет в легкие), и правильное вдыхание состава. Глубоко вдыхая ртом и задерживая на 2-3 секунды, и выдых». Небулайзер высокодисперсный Omron
Comp Air NE-C28 Plus подойдет для такой процедуры. Низко и среднедисперсные пойдут для носоглотки/гортани.

Не болейте!

♥️
Аватара пользователя
MorNat
Супермодератор
 
Сообщения: 4960
Зарегистрирован: Сб фев 12, 2011 7:50 pm
Откуда: U.S. Iowa
Имя: Светлана

Re: По следам Инстаграма doclana.mornatural

Сообщение MorNat » Ср мар 24, 2021 10:31 pm

***
Непростые вопросы ко мне всегда приходят. «Да, конечно, Лана, помогает ивермектин, много исследований, одобрен третьими странами, массе людей помог и помогает, но вот совсем недавно ФДА……». Вот незадача, ФДА предупреждает об опасности его использования и особенно ветеринарного, а вместо него активно настаивает, даже используя слово «ОЧЕНЬ» (не приемлемо в официальных заявлениях/документах, неожиданно такое от ФДА) Молнупиравир.
По ФДА и ивермектину отвечу в сторис, за меня уже все ответили, и я подписываюсь под каждым словом ПРАКТИКОВ США (FLCCC) по КОВИД.

Давайте поговорим о Молнупиравире. Тем более, что он рибонуклеиновый аналог Японского Фавипиравира, а последний Российских Авифавира/Арепливира –тоже часто спрашиваете о них, хотя я уже писала о них в сторис и говорила в ПЭ.

Молнупиравир. Мерк объявляет о чуде лекарстве, которое устраняет Ков-2 в теч 5-ти дней приема у негоспитализированных пациентов, согласно предварительным результатам рандомизированного плацебо-контролируемого исследования фазы IIа. 182 участника (немного), на 15 марта 2021 это НЕ фаза даже 2в, и уж тем более не фаза3; было зарегистрировано 4 серьезных осложнения из 182 (сколько плацебо из них?), но ни одно из них не осветили и не связали с молнупиравиром. И тем не менее препарат уже рекомендуется ФДА.

Препарт, как и вакц-ны, не одобрен ФДА, он рекомендуется в рамках экспериментального применения т е Фазы 2/3 испытаний на людях. Это ВАЖНО знать. В отличии от ивермектина до этого не использовался, ивермектин ОДОБРЕННЫЙ препарат ФДА и утверждённый ВОЗ, используется более 40 лет для лечения паразитозов и показал высокий уровень безопасности (надо сказать на удивление). При КОВИД его имеет право применить любой врач «off label», и более 20% препаратов на Американском Мед рынке так и применяются, но вот, почему-то, ГХХ и ивермектин стали камнями преткновения во время пандемии.

История:

Партнером Мерка выступает Ridgeback Biotherapeutics (Риджбек Байо), у кого Мерк перекупает право на этот препарат.
Год назад Риджбек Байо получил лицензию на использование мольнупиравира от Университета Эмори, а два месяца спустя продал лицензию компании Merck.
Мерк получает огромную поддержку Государства (Админ Байдена) на этот препарат.
Whistleblower(осведомитель, поднявший шум) Рик Брайтер давно «знаком» с этим препаратом. Р Брайтер был директором Управления Перспективных Биомедицинских Разработок при Федеральном Правительстве (BARDA), его руководителем был Док Кадлец. Оба, Брайт и Кадлец встречались с держателем патентов, связанных с молнупиравиром - Джорджем Пейнтером, который возглавляет Институт разработки лекарственных средств Эмори и является Гендиректором Drug Innovation Ventures в Эмори (DRIVE) -некоммерческой компании, принадлежащей Университету Эмори.
В то время Эмори уже получил обещание в
размере 30 миллионов долларов от Национального института аллергии -NIAID (Директор небезызвестный Др Фаучи) и Министерства Обороны на разработку молнупиравира для лечения гриппа и других вирусов (согласно многочисленным источникам, Эмори потратил только около половины Фед-финансирования).

Брайт рассказывает, что Пейнтер на встрече рекламировал молнупиравир как «лекарство от всех вирусов», от гриппа, лихорадки Эбола и др, и попросил

BARDA инвестировать в этот препарат дополнительные миллионы. Брайт указал на то, что для начала Эмори должен провести испытания на безопасность. В феврале 2020 года Пейнтер снова запросил финансирование BARDA для молнупиравира, но на этот раз уже для лечения КОВИД-19.

19 марта 2020 Ridgeback Biotherapeutics подписывает соглашение с Эмори DRIVE, которое предоставило небольшой биотехнологической фирме эксклюзивную лицензию на молнупиравир.

Конкретные условия соглашения не разглашаются, но Эмори обещает, что Риджбек будет нести ответственность за проведение необходимых испытаний, чтобы довести препарат до лицензирования.

Уже на СЛЕДУЮЩИЙ день Пейнтер и другие исследователи разместили предварительный отчет на сайте bioRxiv.org, в котором описываются положительные результаты доклинических исследований, связанных с молнупиравиром, и высказывается предположение, что препарат имеет «потенциальную полезность в качестве эффективного противовирусного средства против SARS-CoV-2».
Примерно в то же время генеральный директор Ridgeback Венди Холман подала запрос о выделении примерно 100 миллионов долларов Федерального финансирования в рамках программы, которую использовали доктор Кадлек и др. Брайт утверждает, что компания пыталась получить финансирование в обход, не предоставив НИКАКОЙ подтверждающей документации для своего БОЛЬШОГО запроса.

Компания Ridgeback не получила Государственного финансирования, но 10 апреля инициировала Фазу I испытания молнупиравира на безопасность в Великобритании.

Затем, 26 мая, Merck (Мега Фарм) и Ridgeback объявили, что они заключили соглашение о сотрудничестве для разработки препарата. Ridgeback получили «авансовый платеж, который не разглашается», а Merck получила эксклюзивные права на разработку и коммерциализацию молнупиравира. Риджбек также имеет право на получение промежуточных выплат и долю от чистой выручки, если препарат будет одобрен ФДА. В свою очередь фармацевтическая промышленность обеспечивает 75% бюджета ФДА лицензирования, и многие их эксперты работают в
фармкомпаниях.
В статье Washington Post, опубликованной в июне 2020, доктор Аарон Кессельхейм – мед профессор Гарварда и врач больницы Бригама для женщин, прокомментировал согласие Университета Эмори передать лицензию Молнупиравира Ridgeback:

«Я бы не подумал, что университеты передают продукты в руки house-flipper.Я бы не подумал, что университеты имеют дело со спекулянтами, как Ridgeback Biotherapeutics». В статье отмечается, что «богатые владельцы» Риджбека, генеральный директор Венди Холман и ее муж, док Уэйн Холман, сделали ставку, которая «окупилась с необычайной скоростью», когда
Риджбек приобрели лицензию на молнупиравир у Эмори университета, а затем в короткие сроки продала ее Merck. Финансовые условия ни в одной из сделок не разглашались.

«Мы не обвиняем Риджбек в каких-либо нарушениях, но эта история позволяет рассуждать о том, как люди с хорошими связями могут получить неплохую прибыль на кандидате, который еще даже не прошел все стадии клинических испытаний, но УЖЕ получил миллионы долларов Федерального финансирования (и это деньги налогоплательщиков)».
«Роль посредников, таких как Ridgeback, взвинчивает цены за счет увеличения «необходимых» затрат. Это также вызывает вопросы о том, кто получает финансовую выгоду от обеспечения монопольных лицензионных прав на препараты, финансируемые Государством».

Джеймс Лав -директор Knowledge Ecology International, назвал двухмесячное владение Риджбеком лицензией на Молнупиравир «molecule flipping». (Flipping –в отношение домов, когда их покупают дешево и перепродают дороже, или затратив немного потом перепродают за «много»).

«На протяжении всей пандемии производители ков-лекарств выигрывали борьбу с общественностью в войне, которую они проигрывали годами. Если молнупиравир поступит на рынок, если он будет одобрен, мы надеемся, что Merck установит на него разумные цены, как акт доброй воли».

А что же на русских просторах по аналогам Молнупиравира? Следственный комитет России задержал одного из крупнейших поставщиков лекарств от КОВИД-19 Бориса Щпигеля –глава Фарм компании Биотэк, который хронически подкармливал взятками главу Пензенской обл Ивана Белозерцева взамен получения госконтрактов. Белозерцев, будучи обеспокоенным эпидемией, исключительно из любви к народу, предоставлял Биотэку –лидеру в фармборьбе с эпидемией тендеры для региональных учреждений здравоохраниения на поставку лекарств. Биотек успешно поставлял в регионы Авифавир и Арепливир, а также дигностические тест системы BIOZEK, общая сумма отгрузок за 2020г -45 миллиардов руб.

Российские Фарм не отстали и смогли флипнуть копеечный японский фавипиравир в новые Авифавир и Арепливир, вместить их испытания по ковид-19 в быстрые 3 месяца, при этом ловким движением рук превратить дешевый дженерик в элегантную «золотую» таблетку (по стоимости).

Известно еще со времен фавипиравира, что у этих лекарств есть очень неприятные побочные эффекты: высокая токсичность для беременных, вызывает опасные генетические мутации плода (уродства и смерть плода), имеют токсическое влияние на репродуктивную систему.

РАНЕЕ это делало невозможным применение таких препаратов в широкой практике. Именно поэтому фавипиравир не был зарегистрирован в США, прошел регистрацию в Японии (как препарат от гриппа), но не применялся до КОВИД.

Но вот теперь ФДА его рекомендует со словом «очень». А для еще бОльшего парадокса, господин Шпигель –глава Биотэка по совместительству Президент Международной правовой организации «Мир без НАЦИЗМА» и бывший тесть Н Баскова, от которого у него внук –маленький Шпигель. Скажите мне, пожалуйста, Друзья, а почему Шпигелю не завозить ивермектин? Почему его нет в Российских аптеках, только вет?

Дорогие мои, я говорила и продолжаю говорить, что если Вы вне политики, именно сейчас, не соприкасались с «системой», дедукция хромает, исследовать не охота, автоматически поклоняетесь, без критической фильтрации, ОРГАНИЗАЦИЯМ/АДМИНИСТРАЦИЯМ/регалиям/СОЮЗАМ, нет профессиональной интуиции, то тяжело, конечно, принимать решения.

Смотрите сколько громких титулов и веских организаций озвучено выше. И тогда, если позволите, я бы посоветовала выбрать грамотного, честного, смелого практика (а лучше парочку), бескорыстного, с богатым житейским опытом и прислушиваться к его мнению.

Сколько у меня было специалистов в прямых эфирах? ПЯТЬ замечательных, грамотных, опытных, при этом принципиальных людей (так получилось, что мужчины, будут и женщины, я думаю), и по всем таким «щекотливым» вопросам, не договариваясь, мы имеем одинаковую точку зрения.

От все Души желаю Вам в это нелегкое время быть ИНТУИТИВНЫМИ.
Аватара пользователя
MorNat
Супермодератор
 
Сообщения: 4960
Зарегистрирован: Сб фев 12, 2011 7:50 pm
Откуда: U.S. Iowa
Имя: Светлана

Re: По следам Инстаграма doclana.mornatural

Сообщение MorNat » Ср мар 31, 2021 9:09 am

Миф «РНК вакцины изменяют ДНК человека»
Мне недавно прислали посты о «МИФАХ вакцин», и по каждому из них, чтобы ответить аргументированно, необходим пост, а неаргументированное утверждение, какой бы «значительный» эксперт не был, согласны? Я не могу согласиться с категорическим утверждением того, что 100% РНК вак-ны НЕ могут повлиять на ДНК и гены.

Сложный пост сегодня, но попытайтесь, Вы же у меня продвинутые пользователи! И тем более это интересно, давайте бросим достойный вызов профессорам, биологам, генетикам и т.д.

В РНК вакцинах содержится СИНТЕЗИРОВАННАЯ мРНК спайка вируса и аргументом того, что мРНК вакцины НЕ МОГУТ влиять на нашу ДНК ( и гены), которая находится в ядре клетки, послужило то, что:

✔️ для репликации вируса или синтеза какого-то белка в клетке, в ядре клетки формируется инструкция –транскрипт на основе части нашей ДНК, что собственно и есть матричная РНК

✔️мРНК, которая затем выходит из ядра в рибосомы и там по этой инструкции начинается воспроизведение вируса в клетке или построение какого-то необходимого белка в здоровой клетке. Т. е аргумент генетиков, молекулярных биологов:

«мРНК покидает ядро и больше туда НЕ возвращается, она отработает свою функцию, и энзимы клетки ее достаточно быстро расщепят. Срок жизни мРНК очень короткий. Также мРНК не может стать снова ДНК и НЕ встраивается обратно в геном. Весь процесс идет ТОЛЬКО в одном направлении ДНК -> РНК -> БЕЛОК, что и есть вирус или часть его, если это вакцина». Поэтому, мол, нет шанса, что введенная мРНК вакцины, даже приближается к ядру клетки и ДНК, она сразу направляется в рибосомы и там воспроизводит новые спайки. Оk.

Но, оказывается, потенциально и лабораторно, что давно уже используют лабораторно, существует так называемый процесс РНК-интерференции, через который можно добиться подавление экспрессии гена на определенных стадиях «жизни» мРНК и в частности на стадии деградации мРНК.

Процесс РНК-интерференции начинается с действия фермента Dicer, который разрезает длинные молекулы РНК (dsRNA) на короткие фрагменты siRNA (деградация мРНК).
Вот такое исследование, в 2003 года ( я нашла 2 подобных исследований):
«Expression profiling reveals off-target gene regulation by RNA» -Действие РНК вне «цели».
(Т е на что еще может повлиять мРНК, кроме того, чтобы послужить инструкцией к репликации вируса или S-белка из вакцины).
В исследовании:
-«Считается, что интерференция РНК требует почти полной идентичности между малой интерферирующей РНК (миРНК) и родственной ей мРНК.
-Здесь мы использовали профили экспрессии генов, чтобы охарактеризовать специфичность подавления генов с помощью миРНК в культивируемых клетках человека.

-Профили транскриптов выявили siRNA -специфические, но не таргет специфические сигнатуры, включая прямое влияние на «молчание» нетаргетируемых генов, содержащих всего одиннадцать смежных нуклеотидов, идентичных с siRNA. Эти результаты демонстрируют, что siRNA могут перекрестно реагировать с мишенями с ограниченным сходством последовательностей».

Перевожу: РНКи (RNAi) довольно хорошо известны взаимодействиями ВНЕ мишени. В процессе деградации мРНК может запуститься процесс РНК –интерференции, который при ряде «совпадений» нуклеотидов вызывает взаимодействие РНКи с неуточненной вакцинной мРНК, и может вызвать подавление экспрессии генов (сайленсинг –заставить молчать) соответсвующего гена.

Т е взаимодействие мРНК с ДНК, с последующим изменением гена, опосредованно, но может иметь место и даже используется в лаб исследованиях (см ниже).

Сравните вот такие две последовательности друг с другом:

TTAAAGATTTTGGTGGTTTTAATTTTTC 1159 TTAAAAATTTTGATGGTTTTAATTTTTC 1132
Как они похожи? Верхняя -mRNA-1273 Модерна.
Вторая из человеческого генома.

Я асбсолютно абстрагируюсь, я не знаю, имеет ли это место в ФИЗИОЛОГИИ, но на мой взгляд, это демонстрирует возможную некоторую правдоподобность взаимодействия некой РНКи с неуточненной вакцинной мРНК.
Знаете, какой ген человека здесь представлен, за что отвечает? Это threonyl-tRNA synthetase 3 (TARS3).

«TARS3 представляет собой ген, кодирующий белок, при нарушении которого развиваются заболевания, среди которых Синдром Антисинтетазы. Синдром антисинтетазы - это хроническое аутоиммунное заболевание, которое поражает мышцы и различные другие части тела.

Признаки и симптомы могут различаться, но могут включать миозит, полиартрит, интерстициальное заболевание легких и феномен Рейно (нарушение кровообращения). Причина неизвестна; однако производство аутоантител, которые атакуют определенные ферменты в организме, называемые «аминоацил-тРНК-синтетазами» связано с причиной Синдрома. Эти аутоантитела могут
возникать после вирусных инфекций или у пациентов может быть генетическая предрасположенность».

Исследование этого гена «до» и «после» в каких-то образцах было бы любопытно, как думаете?
Где применяется подавление гена через РНК-интерференцию, Википедия: «Селективный эффект РНК-интерференции на экспрессию генов делает RNAi полезным инструментом для исследований с использованием клеток и живых организмов, так как синтетические двуцепочечные РНК (в вакцине используется синтетическая РНК спайка), введённые в клетки, вызывают супрессию специфических генов. RNAi используется для крупномасштабных исследований в области молекулярной биологии, биохимии, медицины.
Исторически РНК-интерференция была известна под названием посттранскрипционного сайленсинга (подавления) генов т. е после того, как мРНК –транскрипт вышел уже из ядра. Только после того, как эти предположительно несвязанные процессы (мРНК и ДНК) были исследованы, стало ясно, что все они описывали проявления RNAi»
Мне бы лично хотелось, чтобы производители РНК вакцин (не говоря уже ДНК) в таком вопросе подстраховались и лучше не на шутку. И предъявили свои исследования, экспериментальные доказательства, что такому взаимодействию с нашим ДНК, абсолютно, невозможно случиться.
Уточню для вас, что Спутник –это вакцина на основе вектора –аденовируса, из которого удалены гены, которые способствовали бы его репликации, а вместо их есть синтетическая ДНК вставка S-спайка короны. Аденовирус приносит ДНК спайка к ядру клетки, оно взаимодействует с нашим ДНК, формируется транскрипт –мРНК и т. д. Здесь взаимодействие с нашим ДНК очевидно. Сценарии?
Есть одна деталь, которую могут, как контраргумент предъявить мне молекулярные биологи, научные генетики, в отношение РНК-интерференции, но я не озвучу его….пока (ответ на контраргумент у меня есть). Посмотрим, предъявят ли его те, кто, ТОЖЕ, только в теории, «доказывают» обратное, что мРНК не может повлиять на гены –нашу ДНК, не модифицирует ее, и что это «аж смешно» слышать, что Российский круглый стол, представленный Марий Шукшиной, со всеми Экспертами, и просто неравнодушными специалистами, «не понимают» и т д.
В биологическом организме ВСЕ возможно, самые невероятные сценарии. Это не алгебра, где 2Х2=4, может оказаться и 5.
Если отбросить все риски, и не рассматривать «сценарии», риск ВОЗРАСТЕТ. Если сказать людям, что ничего плохого не может случиться, а это произойдет, то……это преступление в виде бомбы, как минимум, замедленного действия. И тот, кто однозначен в своем идеализированном мнении, берет невероятную ОТВЕТСТВЕННОСТЬ на себя, желаю им оставаться атеистами в таком случае, спокойнее будет жить.
Что же касается меня и Вас –моих клиентов, подписчиков, я верю, что мы должны стремиться к Истине.


Друзья, это Вы мне высылаете посты, в которых засомневались, они вас расстроили, посеяли сомнения, поэтому, давайте, зовите своих профессоров и экспертов.
Посмотрим, что скажут.

♥️
Аватара пользователя
MorNat
Супермодератор
 
Сообщения: 4960
Зарегистрирован: Сб фев 12, 2011 7:50 pm
Откуда: U.S. Iowa
Имя: Светлана

Re: По следам Инстаграма doclana.mornatural

Сообщение MorNat » Вт апр 06, 2021 9:01 am

Легочный фиброз.
КОВИД и без него
.

Прежде чем говорить о посковид фиброзе, замечу, что при регрессе заболевания «матовое стекло» начинает «сжиматься», уплотняться и рентгенологически это напоминают фиброзные изменения (участки, похожие на лоскут узорно скукоженной кожи под утюгом). Но в определенной стадии так выглядит на КТ практически любая пневмония, что настораживает врачей. Фиброз не может сформироваться так быстро, скажем, через 3 недели после заболевания, фиброз формируется 3 и более месяцев. Это следует учесть и не паниковать сразу же, когда вам ставят вердикт постковидный «фиброз».

В зоне риска по формированию поствоспалительного фиброза те люди, которые переболели тяжело или находились на ИВЛ (у последних и так выживаемость менее 10%, я против ИВЛ при КОВИД, до этого нельзя допускать). После бактериальных пневмоний фиброз образуется намного чаще.

Исследование 2018 «Melatonin Protects against Lung Fibrosis by Regulating the Hippo/YAP Pathway» - «Мелатонин в профилактике легочного фиброза».

«Melatonin: the dawning of a treatment forfibrosis» -2015 год (Отличная работа, много можно почерпнуть!).

«Мелатонин нацелен на многочисленные молекулярные пути, что является следствием его антиоксидантного и противовоспалительного действия, которые снижают чрезмерный фиброз. Здесь мы рассматриваем различные защитные эффекты мелатонина против фиброза.

Существует четыре основных фазы фиброгенного ответа, включая:

✔️ первичное повреждение органа
✔️ активацию эффекторных клеток
✔️ выработку внеклеточного матрикса (ЕСМ)
✔️динамические отложения

Мелатонин регулирует каждую из этих фаз.

Кроме того, мелатонин снижает уровень фиброза во многих органах. Мелатонин оказывает антифиброзное действие на сердце, печень, легкие, почки и другие органы. Кроме того, спайки, возникающие после хирургических вмешательств, также подавляются мелатонином. Берите на заметку!

https://onlinelibrary.wiley.com/doi/pdf ... /jpi.12302

«MELATONIN ALLEVIATES BLEOMYCIN-INDUCED PULMONARY FIBROSIS IN MICE» -«Мелатонин облегчает блеомицин индуцированый фиброз легких у мышей».
Из исследований NAC –N-ацети-цистеин:
«В однолетнем исследовании 600 мг NAC два раза в день значительно улучшили функцию легких и симптомы у пациентов со стабильной ХОБЛ –Хронические Обструктивные Заболевания Сердца».

«Людям с хроническим бронхитом также может помочь НАК».

«Бронхит возникает, когда слизистые оболочки бронхиальных проходов в легких воспаляются, опухают и перекрывают дыхательные пути к легким. Разжижая слизь в бронхах и повышая уровень глутатиона, NAC может помочь снизить тяжесть и частоту хрипов, кашля и респираторных приступов».

«Помимо облегчения ХОБЛ и бронхита, NAC может улучшить другие состояния легких и дыхательных путей, такие как муковисцидоз, астма и легочный фиброз, а также симптомы
заложенности носа и пазух из-за аллергии или инфекций».

2019 год «Эффективность и безопасность терапии N – ацетил-цистеином при идиопатическом фиброзе легких: обновленный систематический обзор и мета-анализ»:

В общей сложности 21 контролируемое испытание, оценивающее эффективность и безопасность терапии NAC для идиопатического фиброза легких. Анализ объединенных данных показал, что по сравнению с контрольным леченим терапия NAC уменьшала падение функции легких и замедляла прогрессирование заболевания. Эти результаты свидетельствуют о хорошей эффективности, переносимости и безопасности лечения. Кроме того, анализ подгрупп показал, что комбинированная терапия, включающая NAC, фиброза может быть более эффективной, чем монотерапия с NAC, в то время как пероральное введение NAC было безопаснее, чем ингаляция».

Термин «фиброз» -обозначает рубцеобразование и может быть вызван многими причинами:
▪️хронические воспалительные процессы
▪️инфекции
▪️факторы окружающей среды (асбест, кремнезем, воздействие определенных токсических газов)
▪️воздействие ионизирующего излучений
▪️хронические системные, аутоиммунные заболевания, как волчанка, ревматоидный артрит
▪️прием определенной ФАРМ

В состоянии, известном как гиперчувствительный пневмонит, фиброз легких может развиться в результате повышенной иммунной реакции на вдыхаемую органическую пыль или профессиональные химические вещества.

Часто возникает в результате вдыхания пыли, зараженной бактериальными, грибковыми (аспергиллез) или животными продуктами.

В соответствии с причинами необходимы определенные подходы и препараты.

ФИБРОЗ легких сапплементация:

См пост «подходы к аутоиммунным заболеваниям» и читать ветку на форуме mornatural «аутоиммунные» т. к фиброз легких нередко возникает на фоне аутоиммунных заболеваний.

✔️NAC 600 mg – 3 -4 раза в день в промежутках между едой

✔️Мелатонин -3 -6 мг в день на ночь.

✔️Наттокиназа/серрапептаза (интересные

исследования есть Японские по серрепептазе и заболеваниям легких) и натто:

Исследование: «Nattokinase decreases plasma levels of fibrinogen, factor VII, and factor VIII in human subjects» -«Наттокиназа снижает фибрин в плазме, фактор 7, фактор 8 в человеческих исследованиях»

См мои посты «системные энзимы» -их несколько частей. Если из магазина @mornatural_rus, то пьем сарратиа и натто по 1 капс утром натощак и на ночь перед сном, ужин должен быть 3 часа перед этим, если ужинаете поздно, то пить за час до ужина.

Системные энзимы -мои ПОСТЫ в ленте изучите, пож-та.

✔️Gingo biloba по 1Х 2 раза в день за 20 мин до еды.

Исследование 2010 «Effect of ginkgo biloba extract against pulmonary fibrosis and its mechanisms” – «Действие экстракта гиндо билоба на легочный фиброз, механизм действия».

✔️0.1% Метиленовый синий в небулайзере (используется при фиброзе в Индии, но длительно). Имеет противовирусный, противобактериальный и противогрибковый эффекты.


В магазине
@mornatural_rus
Фармакологический
Methylene Blue 1%
USP Grade
- Biopharm - 50 mL
При ингаляции (используется маска) - буквально 1-2 капли, но не 1%, а 0.1% раствора, кожа лица может окраситься, но это временно. Или\и под язык, тоже 0.1% - 1-2 мл 1-2 раза в день. Нельзя детям до 12 лет, беременным и кормящим. Людям с дефицитом G6PD. Про МС был пост ранее.

Более подробно о фиброзе я расскажу в вебинаре «Постковид».
Аватара пользователя
MorNat
Супермодератор
 
Сообщения: 4960
Зарегистрирован: Сб фев 12, 2011 7:50 pm
Откуда: U.S. Iowa
Имя: Светлана

Re: По следам Инстаграма doclana.mornatural

Сообщение MorNat » Сб апр 10, 2021 9:55 pm

Подходы к фертильности.
Общее, да, можем рассмотреть, но частные детали в каждом случае, нет.

Приведу пример, очень простой. Девушка здесь -США, 30 лет, вес 48 кг, очевидных диагнозов нет, не может зачать в течение 3 лет, менструальный цикл 26 дней. Врачи –классики (США) после рассмотрения кое-каких гормонов, сданных вне цикла, и обычной панели по здоровью, ничего не нашли, все отлично и «давай, пробуй набрать вес».

В Альтернативном обследовании выяснялись: высокий кортизол (слюна), низкий прегненолон, низкий прогестерон, низкий холестерин, высокий СРБ, высокий ГСПГ, низкая норма ДГА-С, инсулин 11, по щитовидной анализы неплохие, но показывают «sluggish» щитовидную (из-за стресса).

Девушка худенькая, я ожидала, как раз-таки, низкого эстрогена. Частые головные боли, гипотоник 90/60. Более склонна к углеводам, чем к белковой пище, но и особыми американскими «безобразиями» в рационе не отличается, спортом себя не убивает.

По пищевой панели Ig G, было МНОГО нетолерантностей, но очень высокий счет на яйца, животная молочка, шоколад (есть крейвинс –любит, хочет!). СРБ, инсулин снизили только диетой, на основе этого анализа.

Шоколад заменили магнием и качественным лецитином, крэйвинс по нему ушли через 2 мес. Головные боли на фоне диеты и сапплементации в теч 6 мес ушли совсем! Это достаточно легкий случай по головным болям, т к проблема была в инсулине и в пищевых нетолерантностях. Молочные продукты повышают выброс инсулина, помним об этом, а высокий инсулин –это воспаление и это ПРОандроген.

Кортизол, именно ее кортизол, снижали на основе препарата, который я выбрала с: ашвагандой, ликорик (солодка), фосфатидилсерин, lemon balm, passion flower. Добавили DHEA, но аккуратно, анализ пересдали через 6 нед.

По щитовидной конкретно, препаратов даже и не применяли. Богатый вит/мин комплекс и ряд др препаратов, включая трансдермальный прогестерон.

То есть индивидуальность подходов будет иметь место. Девушка забеременела самостоятельно через 7 мес.

Нутрицевтики/препараты/ подходы по фертильность.

Часто прогестерон, НО НЕ всегда, низкий. См пост по «прогестерон/эстроген соотношение».

Я предпочитаю трансдермальный, микронизированный прогестерон т к дозы нужны меньшие, сразу попадает в кровь, в обход печени. Рrogestelle препарат моего выбора уже МНОГО лет (магазин @mornatual_rus), дополнительная инфо на форуме mornaturalforums.rus
Если я хочу дать возможность яичникам отдохнуть, то я предлагаю использовать его с 5 по 28 день, или до первого дня месячных, и так на 3-4 мес. Это подавляет овуляцию на эти месяцы и затем втирать его в кожу уже сразу после дня овуляции и до первого дня месячных, или до 28 дня цикла.
После такого «отдыха» яичники рады проявить ИНИЦИАТИВУ. Средняя доза 40-60 мг (1 -1.5 пипетки Х 2 раза в день препарата progestelle из нашего магазина).
ВСЕГА в это время идут НУТРИЕНТЫ ОБОИМ партнерам. У мужчин очень похожие нутриенты, но немного отличаются. Пока скажу, что вит/мин комплекс/Коэнзим Ку 10/Л-карнитин ТОЧНО.
90 -120 дней необходимы на то, чтобы яичники и яички
«взяли» нутриенты и это не о курсе 3 мес всего, а о МИНИМУМЕ их приема.
Особенности с прогестероном:
Никогда не останавливаете прогестерон, если забеременели на нем, он продолжает идти в течение, как минимум, до 16 нед беременности и ЗАТЕМ уже, ПОСТЕПЕННО, снижая его по полпипетки каждую неделю.
10% женщин нуждаются в нем до КОНЦА беременности, особенно те, у кого образуются антитела к прогестерону.
1% женщин имеют плохую всасываемость трансдермальных препаратов, таким тогда микронизированные формы орального прогестерона необходимы или влагалищного.
Вит Е повышает чувствительность рецепторов к прогестерону, я предпочитаю в сапплементации несколько его форм в одном препарате, от 400 мг до 800 мг в день –первые 3 мес.
Учитываем статусы других жирорастворимых витаминов: А, Д, К. Не пить вит А более 25 000 ЕД (палмитата) в день, если его статус в минусах. Их пьем НА ФОНЕ вит/мин комплекса.
Витамин D помогает поднять низкий уровень АМГ и защищает оставшийся запас яичников от дальнейшей деградации. Есть данные за то, что он способствует здоровой имплантации эмбриона и снижает риск прерывания беременности.
Chaste Tree, Vitex - Fruit Extract – это растительный препарат; может помочь при: ПМС, СПКЯ, короткая лютеиновая фаза, низкий ур прогестерона, ановуляция, эстрогендоминирование. Используются небольшие дозы, но долго (3-6-9 мес), начало действия после 4-6 нед приема.
ДНЕА –это гормональный предшественник в надпочечниках, влияет на уровень тестостерона и эстрогена. Женщинам с плохим овариальным резервом, которые также плохо отреагировали на ЭКО,
давали DHEA (исследование). У этих женщин была более высокая частота наступления беременности и более высокий резерв яичников, чем в группе, не принимавшей ДГЭА. Этот препарат назначается с учетом анамнеза, диагнозов и анализов, но нередко имеет место для подготовки к ЭКО.
Сдать анализ на полиморфизмы фолатного цикла, оцениваем статус В9 и В12, соответственно подбираются дозы. Но в среднем фолиевая в форме МТГФ (MTHF) в дозе 1 000 мкг необходима. Сапплементация В9/В12 идет на фоне вит/мин КОМПЛЕКСА, курсом.
Вит/мин комплекс. Я нередко использую выбранные мною Prenatal комплексы, но не обязательно. Главное КАЧЕСВО, индивидуальные дозы, активные формы, многокомпонентный комплекс.
Хром полиНИКОТИНАТ, у многих есть дефицит хрома -раз, поможет разбудить инсулиновые рецепторы и особенно для женщин с СПКЯ, поможет с крэйвинс к сладкому и мучному. Курсом от 400 мкг до 1200 мкг в разделенных дозах перед едой -1-3 мес.
Инозитол, myo-инозитол, ди-кайро-инозитол (D-Chiro Inositol). Инозитол помогает повысить AMГ и назначается при СПКЯ особенно (помогает овуляции). Это и липотропный агент -помогает печени, сосудам.
По исследованию 2010 года сочетание мио-инозитола, фолата и мелатонина показало улучшение качества яйцеклеток. Д-кайро-инозитола (лучшая форма для СПКЯ) много в клетчатке гречневой, ее трудно найти, в магазине она представлена, классная штука, печь мафины из нее (были сторис по ней и см посты магазина).
Стеролы из клетчатки (рисовый брэн, яблочный пектин и др) – формулы с разными формами клетчаток помогают восстановить гормональный баланс и стабилизировать сахар крови, скачки инсулина. Особенно женщинам, любящим поесть, склонным к запорам, с излишками эстрогена. У кого ЛЕКТИНфобия, читайте мой пост «Лектины/фитины». ФИТИН… это, кстати, ИНОЗИТ –форма инозитола.
Железодефицит/анемия, необходимо разрешить, если он имеет место. Найти их причину. См мои сторис по «анемии» -все препараты НАГЛЯДНО там даны. Низкий уровень железа, анемия влияет на овуляцию, но самое главное, что потом на развитие плода.
Протеин -изолят (молочный или веганский)/коллаген/свободные аминокислоты. В зависимости от вашей ситуации или/или/или. Например, Хашимото или CПКЯ -не стоит использовать молочный протеин. Многие аминокислоты на н/н в крови, тогда порошковые свободные аминокислоты. Необходим «качественный» коллаген для вынашивания, поэтому здесь же уместен будет и вит С! Вит С играет свою роль для фертильности.
Цинк -известный стимулятор фертильности. Улучшает общую фертильность, качество яйцеклеток и повышает коэффициент живорождения. Если его статус не страдает, то хватает доз из вит/мин комплекса.

Жирные кислоты –рыбий жир (см мой ПЭфир по нему).
Улучшает качество яйцеклеток и помогает с овуляцией, повышает шансы у женщин после 30. Хотя масло бурачника/вечерней примулы я применяю тоже.

Коэнзим Q10, полюбили и репродуктологи; для повышения качества яйцеклеток и повышения частоты наступления беременности, назначают до циклов ЭКО и извлечения яйцеклеток. Пьете курсами.

Л-аргинин – антиоксидант (не пойдет, если частое обострение герпеса) -улучшает генитальный кровоток, либидо, качество яйцеклеток.

Л-карнитин (я давала подробные сторис по карнитинам, найдите)-способствует фертильности и помогает повысить качество яйцеклеток (подвижность сперматозоидов тоже), предотвращая повреждение ДНК клеток.

Полифенолы из экстракта зеленого чая и сам зеленый чай: антиоксидант, может повысить шансы зачатия ВДВОЕ, ПРОФАЛАКТИКА КОВИД сейчас (в сочетании с
небольшими дозами цинка), помогает созреванию яйцеклеток, улучшает образование цервикальной слизи, что помогает сперматозоидам двигаться, поддерживает им жизнь до 5-и дней.

Растительные препараты для фертильности? Да, конечно, здесь назовем MACA, но есть нюансы. Назовете нюансы по MACA, связанные с фертильностью? Хорошо при инфертильность на фоне стресса, эндометриозе, среднее качество яйцеклеток, гормональный дисбаланс, либидо.

Озонотерапия –отлично, Большая Аутогемотерапия (Киев, Москва, Ростов, Латвия –см мой гид по Озону) при: низкий резерв яичников, низкое качество яицеклеток, плохой ответ на ЭКО, тонкий эндометрий, плохое количество/морфология/подвижность сперматозоидов, потери беременностей.

Массаж для фертильности –видео выложу в сторис + курсом гинкго билоба.
Назовете эффективные продукты питания для фертильности? Давайте, по 3 продукта и обоснование, почему, будет интересно! Я включусь.

Яйцеклетки и сперматозоиды живут 3 дня, вам надо сосредоточиться на 6 днях вокруг овуляции, НО! Большая ошибка, часто встречаю такое. Уважаемые Жены, редко и Мужья, прекратите превращать это в запланированное мероприятие со строгим регламентом и жестким расписанием, это ужасно. Должны присутствовать Любовь и удовольствие, а не напряженная «работа», а то семьи начинают разваливаться, а дети не хотят приходить через такой конвейер.
Удачи!
♥️
Аватара пользователя
MorNat
Супермодератор
 
Сообщения: 4960
Зарегистрирован: Сб фев 12, 2011 7:50 pm
Откуда: U.S. Iowa
Имя: Светлана

Пред.

Вернуться в Симптомы: поиск решений

Кто сейчас на конференции

Сейчас этот форум просматривают: нет зарегистрированных пользователей и гости: 4

mornatural.com   •    On-Line Store   •    Forums